Review



plko shrna cre plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc plko shrna cre plasmid
    Plko Shrna Cre Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+shrna+cre+plasmid/LV-Cre+pLKO%2E1+(Plasmid+%2325997)/pm34686327-379-13-23
    Average 93 stars, based on 26 article reviews
    plko shrna cre plasmid - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: Pan-cancer analysis of non-coding transcripts reveals the prognostic onco-lncRNA HOXA10-AS in gliomas.
    Article Snippet: .. Lentivirus mediated shRNA knockdown of HOXA10-AS The lentiviral vector pLKO-shRNA-H2BRFP-P2A-Puro was engineered from pLKO shRNA-Cre plasmid (kindly provided by Elaine Fuchs, Rockefeller University; Addgene #25997) by replacing the Cre cassette with a H2BRFP-P2A-Puro cassette. shRNAs targeting HOXA10-AS (shAS#3, ACCTGGAGACGATTTCAACTG; shAS#6, GAGAAAGGTGGATCCCAACAA), and the non-targeting scramble control shScr (CCTAAGGTTAAGTCGCCCTCG) were cloned into pLKO-shRNA-H2BRFP-P2A-Puro. .. This virus was produced in 293T cells using the pLKO-shRNA-H2BRFP-P2A-Puro plasmid and lentiviral packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) and glioma cells were spin-infected at 1100 g for 1 hour as described previously (Loganathan et al., 2020).

    Knockdown:

    Article Title: Pan-cancer analysis of non-coding transcripts reveals the prognostic onco-lncRNA HOXA10-AS in gliomas.
    Article Snippet: .. Lentivirus mediated shRNA knockdown of HOXA10-AS The lentiviral vector pLKO-shRNA-H2BRFP-P2A-Puro was engineered from pLKO shRNA-Cre plasmid (kindly provided by Elaine Fuchs, Rockefeller University; Addgene #25997) by replacing the Cre cassette with a H2BRFP-P2A-Puro cassette. shRNAs targeting HOXA10-AS (shAS#3, ACCTGGAGACGATTTCAACTG; shAS#6, GAGAAAGGTGGATCCCAACAA), and the non-targeting scramble control shScr (CCTAAGGTTAAGTCGCCCTCG) were cloned into pLKO-shRNA-H2BRFP-P2A-Puro. .. This virus was produced in 293T cells using the pLKO-shRNA-H2BRFP-P2A-Puro plasmid and lentiviral packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) and glioma cells were spin-infected at 1100 g for 1 hour as described previously (Loganathan et al., 2020).

    Plasmid Preparation:

    Article Title: Pan-cancer analysis of non-coding transcripts reveals the prognostic onco-lncRNA HOXA10-AS in gliomas.
    Article Snippet: .. Lentivirus mediated shRNA knockdown of HOXA10-AS The lentiviral vector pLKO-shRNA-H2BRFP-P2A-Puro was engineered from pLKO shRNA-Cre plasmid (kindly provided by Elaine Fuchs, Rockefeller University; Addgene #25997) by replacing the Cre cassette with a H2BRFP-P2A-Puro cassette. shRNAs targeting HOXA10-AS (shAS#3, ACCTGGAGACGATTTCAACTG; shAS#6, GAGAAAGGTGGATCCCAACAA), and the non-targeting scramble control shScr (CCTAAGGTTAAGTCGCCCTCG) were cloned into pLKO-shRNA-H2BRFP-P2A-Puro. .. This virus was produced in 293T cells using the pLKO-shRNA-H2BRFP-P2A-Puro plasmid and lentiviral packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) and glioma cells were spin-infected at 1100 g for 1 hour as described previously (Loganathan et al., 2020).

    Control:

    Article Title: Pan-cancer analysis of non-coding transcripts reveals the prognostic onco-lncRNA HOXA10-AS in gliomas.
    Article Snippet: .. Lentivirus mediated shRNA knockdown of HOXA10-AS The lentiviral vector pLKO-shRNA-H2BRFP-P2A-Puro was engineered from pLKO shRNA-Cre plasmid (kindly provided by Elaine Fuchs, Rockefeller University; Addgene #25997) by replacing the Cre cassette with a H2BRFP-P2A-Puro cassette. shRNAs targeting HOXA10-AS (shAS#3, ACCTGGAGACGATTTCAACTG; shAS#6, GAGAAAGGTGGATCCCAACAA), and the non-targeting scramble control shScr (CCTAAGGTTAAGTCGCCCTCG) were cloned into pLKO-shRNA-H2BRFP-P2A-Puro. .. This virus was produced in 293T cells using the pLKO-shRNA-H2BRFP-P2A-Puro plasmid and lentiviral packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) and glioma cells were spin-infected at 1100 g for 1 hour as described previously (Loganathan et al., 2020).

    Clone Assay:

    Article Title: Pan-cancer analysis of non-coding transcripts reveals the prognostic onco-lncRNA HOXA10-AS in gliomas.
    Article Snippet: .. Lentivirus mediated shRNA knockdown of HOXA10-AS The lentiviral vector pLKO-shRNA-H2BRFP-P2A-Puro was engineered from pLKO shRNA-Cre plasmid (kindly provided by Elaine Fuchs, Rockefeller University; Addgene #25997) by replacing the Cre cassette with a H2BRFP-P2A-Puro cassette. shRNAs targeting HOXA10-AS (shAS#3, ACCTGGAGACGATTTCAACTG; shAS#6, GAGAAAGGTGGATCCCAACAA), and the non-targeting scramble control shScr (CCTAAGGTTAAGTCGCCCTCG) were cloned into pLKO-shRNA-H2BRFP-P2A-Puro. .. This virus was produced in 293T cells using the pLKO-shRNA-H2BRFP-P2A-Puro plasmid and lentiviral packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) and glioma cells were spin-infected at 1100 g for 1 hour as described previously (Loganathan et al., 2020).



    Similar Products

    plko shrna cre plasmid  (Addgene inc)
    93
    Addgene inc plko shrna cre plasmid
    Plko Shrna Cre Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+shrna+cre+plasmid/LV-Cre+pLKO%2E1+(Plasmid+%2325997)/pm34686327-379-13-23
    Average 93 stars, based on 1 article reviews
    plko shrna cre plasmid - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results